Description: Split manuals.
Author: Sascha Steinbiss <steinbiss@zbh.uni-hamburg.de>
--- a/doc/manuals/matstat.tex
+++ b/doc/manuals/matstat.tex
@@ -1,2 +1,162 @@
-\def\BuildMatstat{}
-\input{uniquesub}
+\documentclass[12pt]{article}
+\usepackage[a4paper,top=20mm,bottom=20mm,left=20mm,right=20mm]{geometry}
+\usepackage{url}
+\usepackage{alltt}
+\usepackage{xspace}
+\usepackage{times}
+\usepackage{listings}
+
+\usepackage{verbatim}
+\usepackage{ifthen}
+\usepackage{optionman}
+
+\newcommand{\Substring}[3]{#1[#2..#3]}
+
+\newcommand{\Program}[0]{\texttt{matstat}\xspace}
+\newcommand{\MS}[1]{\mathit{ms(s,#1)}}
+\title{\Program: a program for computing\\
+       matching statistics\\
+       a manual}
+
+\author{\begin{tabular}{c}
+         \textit{Stefan Kurtz}\\
+         Center for Bioinformatics,\\
+         University of Hamburg
+        \end{tabular}}
+\date{26/08/2013}
+
+\pdftrailerid{}
+\begin{document}
+\maketitle
+
+\section{The program \Program}
+
+The program \Program is called as follows:
+\par
+\noindent\Program [\textit{options}] \Showoption{query} \Showoptionarg{files} [\textit{options}] 
+\par
+\Showoptionarg{files} is a white space separated list of at least one 
+filename. Any sequence occurring in any file specified in \Showoptionarg{files}
+is called \textit{unit} in the following.
+In addition to the mandatory option \Showoption{query}, the program
+must be called with either option \Showoption{pck} or \Showoption{esa}
+which specify to use a packed index or an enhanced suffix array for 
+a given set of subject sequences.
+
+\Program computes the  \textit{matching statistics} for each unit. That is, 
+for each position \(i\) in 
+each unit, say \(s\) of length \(n\), \(\MS{i}=(l,j)\) is computed. Here
+\(l\) is the largest integer such that \(\Substring{s}{i}{i+l-1}\) matches
+a substring represented by the index and \(j\) is a start position of the
+matching substring in the index. We say that \(l\) is the length of \(\MS{i}\)
+and \(j\) is the subject position of \(\MS{i}\).
+
+The following options are available in \Program:
+
+\begin{Justshowoptions}
+\begin{comment}
+\Option{fmi}{$\Showoptionarg{indexname}$}{
+Use the old implementation of the FMindex. This option is not recommended.
+}
+\end{comment}
+
+\Option{esa}{$\Showoptionarg{indexname}$}{
+Use the given enhanced suffix array to compute the matches.
+}
+
+\Option{pck}{$\Showoptionarg{indexname}$}{
+Use the packed index (an efficient representation of the FMindex)
+to compute the matches.
+}
+
+
+\Option{query}{$\Showoptionarg{files}$}{
+Specify a white space separated list of query files containing the units.
+At least one query file must be given. The files may be in 
+gzipped format, in which case they have to end with the suffix \texttt{.gz}.
+}
+
+\Option{min}{$\ell$}{                                                           
+Specify the minimum value $\ell$ for the length of the matching statistics.
+That is, for each unit \(s\) and each position \(i\) in \(s\), the program 
+reports all values \(i\) and \(\MS{i}\) if the 
+length of \(\MS{i}\) is at least \(\ell\).
+}
+
+\Option{max}{$\ell$}{
+Specify the maximum length $\ell$ for the length of the matching statistics.
+That is, for each unit \(s\) and each positions \(i\) in \(s\), the program 
+reports the values \(i\) and \(\MS{i}\) if the length of \(\MS{i}\)
+is at most \(\ell\).
+}
+
+\Option{output}{(\Showoptionkey{subjectpos}$\mid$\Showoptionkey{querypos}$\mid$\Showoptionkey{sequence})}{
+Specify what to output. At least one of the three keys words
+$\Showoptionkey{subjectpos}$,
+$\Showoptionkey{querypos}$, and
+$\Showoptionkey{sequence}$ must be used.
+Using the keyword $\Showoptionkey{subjectpos}$ shows the 
+subject position of the matching statistics.
+Using the keyword $\Showoptionkey{querypos}$ shows the query position.
+Using the keyword $\Showoptionkey{sequence}$ shows the sequence content
+}
+
+\Helpoption
+
+\end{Justshowoptions}
+The following conditions must be satisfied:
+\begin{enumerate}
+\item
+Either option  \Showoption{min} or option \Showoption{max} must be used.
+\item
+If both options \Showoption{min} and \Showoption{max} are used, then
+the value specified by option \(\Showoption{min}\) must be smaller
+than the value specified by option \(\Showoption{max}\).
+\item
+Either option \Showoption{pck} or \Showoption{esa} must be used. Both cannot
+be combined.
+\end{enumerate}
+
+\section{Examples}
+
+Suppose that in some directory, say \texttt{homo-sapiens}, we have 25 gzipped
+fasta files containing all 24 human chromomsomes plus one file with 
+mitrochondrial sequences. These may have been downloaded from
+\url{ftp://ftp.ensembl.org/pub/current_fasta/homo_sapiens_47_36i/dna}.
+
+In the first step, we construct the packed index for the entire genome:
+
+\begin{Output}
+gt packedindex mkindex -dna -dir rev -parts 15 -bsize 10 -locfreq 32
+                       -indexname human-all -db homo-sapiens/*.gz
+\end{Output}
+
+The program runs for almost two hours and delivers 
+an index \texttt{human-all} consisting of three files:
+
+\begin{Output}
+ls -lh human-all.*
+-rw-r----- 1 kurtz gistaff   37 2008-01-24 00:47 human-all.al1
+-rw-r----- 1 kurtz gistaff 1.9G 2008-01-24 02:37 human-all.bdx
+-rw-r----- 1 kurtz gistaff 3.4K 2008-01-24 02:37 human-all.prj
+\end{Output}
+
+This is used in the following call to the program \Program:
+
+\begin{Output}
+gt matstat -output subjectpos querypos sequence -min 20 -max 30 
+           -query queryfile.fna -pck human-all
+unit 0 (Mus musculus, chr 1, complete sequence)
+22 20 390765125 actgtatctcaaaatataaa
+253 21 258488266 gggaataaacatgtcattgag
+254 20 258488267 ggaataaacatgtcattgag
+275 20 900483549 taattctatttttctttctt
+480 20 1008274536 gcttgaagatcatgatccag
+..
+\end{Output}
+Here, the first column shows the relative positions in unit 0 for which the
+length of the matching statistics is between 20 and 30. The second column is
+the corresponding length value. The third column shows position of the
+matching sequence in the index, and the fourth shows the sequence content.
+
+\end{document}
--- a/doc/manuals/uniquesub.tex
+++ b/doc/manuals/uniquesub.tex
@@ -8,38 +8,15 @@
 
 \usepackage{verbatim}
 \usepackage{ifthen}
-\usepackage{comment}
 \usepackage{optionman}
 
-\ifthenelse{\isundefined{\BuildMatstat}}{%
-\includecomment{AboutUniquesub}
-\excludecomment{AboutMatstat}
-\newcommand{\AboutUniquesubcmd}[1]{#1}
-\newcommand{\AboutMatstatcmd}[1]{}
-}{%
-\includecomment{AboutMatstat}
-\excludecomment{AboutUniquesub}
-\newcommand{\AboutMatstatcmd}[1]{#1}
-\newcommand{\AboutUniquesubcmd}[1]{}
-}
-
 \newcommand{\Substring}[3]{#1[#2..#3]}
 
-\begin{AboutUniquesub}
 \newcommand{\Program}[0]{\texttt{uniquesub}\xspace}
 \newcommand{\Mup}[1]{\mathit{mup(s,#1)}}
 \title{\Program: a program for computing\\
        minimum unique substrings\\
        a manual}
-\end{AboutUniquesub}
-
-\begin{AboutMatstat}
-\newcommand{\Program}[0]{\texttt{matstat}\xspace}
-\newcommand{\MS}[1]{\mathit{ms(s,#1)}}
-\title{\Program: a program for computing\\
-       matching statistics\\
-       a manual}
-\end{AboutMatstat}
 
 \author{\begin{tabular}{c}
          \textit{Stefan Kurtz}\\
@@ -66,7 +43,6 @@
 which specify to use a packed index or an enhanced suffix array for 
 a given set of subject sequences.
 
-\begin{AboutUniquesub}
 \Program computes for all positions \(i\) in each unit, say \(s\) of length
 \(n\), the length \(\Mup{i}\) of the minimum unique prefix 
 at position \(i\), if it exists. Uniqueness always refers to all substrings
@@ -86,17 +62,6 @@
 substring. In this case, the program reports nothing for the corresponding
 unit. The program was developed for designing whole genome tiling arrays.
 The corresponding publication is \cite{GRAE:NIE:KUR:HUY:BIR:STU:FLI:2007}.
-\end{AboutUniquesub}
-
-\begin{AboutMatstat}
-\Program computes the  \textit{matching statistics} for each unit. That is, 
-for each position \(i\) in 
-each unit, say \(s\) of length \(n\), \(\MS{i}=(l,j)\) is computed. Here
-\(l\) is the largest integer such that \(\Substring{s}{i}{i+l-1}\) matches
-a substring represented by the index and \(j\) is a start position of the
-matching substring in the index. We say that \(l\) is the length of \(\MS{i}\)
-and \(j\) is the subject position of \(\MS{i}\).
-\end{AboutMatstat}
 
 The following options are available in \Program:
 
@@ -123,7 +88,6 @@
 gzipped format, in which case they have to end with the suffix \texttt{.gz}.
 }
 
-\begin{AboutUniquesub}
 \Option{min}{$\ell$}{
 Specify the minimum length $\ell$ of the minimum unique prefixes.
 That is, for each unit \(s\) and each positions \(i\) in \(s\), the program 
@@ -143,34 +107,6 @@
 Using the keyword $\Showoptionkey{sequence}$ shows the sequence content
 of the match.
 }
-\end{AboutUniquesub}
-
-\begin{AboutMatstat}
-\Option{min}{$\ell$}{
-Specify the minimum value $\ell$ for the length of the matching statistics.
-That is, for each unit \(s\) and each position \(i\) in \(s\), the program 
-reports all values \(i\) and \(\MS{i}\) if the 
-length of \(\MS{i}\) is at least \(\ell\).
-}
-
-\Option{max}{$\ell$}{
-Specify the maximum length $\ell$ for the length of the matching statistics.
-That is, for each unit \(s\) and each positions \(i\) in \(s\), the program 
-reports the values \(i\) and \(\MS{i}\) if the length of \(\MS{i}\)
-is at most \(\ell\).
-}
-
-\Option{output}{(\Showoptionkey{subjectpos}$\mid$\Showoptionkey{querypos}$\mid$\Showoptionkey{sequence})}{
-Specify what to output. At least one of the three keys words
-$\Showoptionkey{subjectpos}$,
-$\Showoptionkey{querypos}$, and
-$\Showoptionkey{sequence}$ must be used.
-Using the keyword $\Showoptionkey{subjectpos}$ shows the 
-subject position of the matching statistics.
-Using the keyword $\Showoptionkey{querypos}$ shows the query position.
-Using the keyword $\Showoptionkey{sequence}$ shows the sequence content
-}
-\end{AboutMatstat}
 
 \Helpoption
 
@@ -214,7 +150,6 @@
 
 This is used in the following call to the program \Program:
 
-\begin{AboutUniquesub}
 \begin{Output}
 gt uniquesub -output querypos -min 20 -max 30 -query queryfile.fna 
              -pck human-all
@@ -250,27 +185,7 @@
 1013 21 gttttttttttttactttata
 ...
 \end{Output}
-\end{AboutUniquesub}
-
-\begin{AboutMatstat}
-\begin{Output}
-gt matstat -output subjectpos querypos sequence -min 20 -max 30 
-           -query queryfile.fna -pck human-all
-unit 0 (Mus musculus, chr 1, complete sequence)
-22 20 390765125 actgtatctcaaaatataaa
-253 21 258488266 gggaataaacatgtcattgag
-254 20 258488267 ggaataaacatgtcattgag
-275 20 900483549 taattctatttttctttctt
-480 20 1008274536 gcttgaagatcatgatccag
-..
-\end{Output}
-Here, the first column shows the relative positions in unit 0 for which the
-length of the matching statistics is between 20 and 30. The second column is
-the corresponding length value. The third column shows position of the
-matching sequence in the index, and the fourth shows the sequence content.
-\end{AboutMatstat}
 
-\begin{AboutUniquesub}
 %\bibliographystyle{plain}
 %\bibliography{defines,kurtz}
 \begin{thebibliography}{1}
@@ -282,5 +197,4 @@
 \newblock {\em {Bioinformatics}}, {23 ISMB/ECCB 2007}:{i195--i204}, 2007.
 
 \end{thebibliography}
-\end{AboutUniquesub}
 \end{document}
